View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10085_high_5 (Length: 308)
Name: NF10085_high_5
Description: NF10085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10085_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 7 - 293
Target Start/End: Original strand, 11175017 - 11175303
Alignment:
Q |
7 |
gaaagtgttggccgtgccggtaagcttcctggtgtggagtatcattcttcacaagattttattgaatttgagagcagaagctcccaacataaacaacttt |
106 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11175017 |
gaaagtgttggccgtgctggtaagcttcctggtgtggagtatcattcttcacaagattttattgaatttgagagcagaagctcccaacataaacaacttt |
11175116 |
T |
 |
Q |
107 |
tggatgcaataaaagatgaccaaaactttatggttggattgcatggtatgggagggactggtaagacaacattggtgcaaaaagttggtaatgaagtcaa |
206 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11175117 |
tggatgcaataaaagatgaccacaactttatggttggattgcatggtatgggagggactggtaagacaacattggtgcaaaaagttggtaatgaagtcaa |
11175216 |
T |
 |
Q |
207 |
aagatcaaacctatttgatgaagtcatctttactacagtgtcgcatgcccctgatatcagaaagattcaagataatattgctgtccc |
293 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
11175217 |
aagatcaaacctatttgatgaagtcatctttactacagtgtcgcatgcccctgatatcagaaagattcaagataacattgctgtccc |
11175303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 103 - 158
Target Start/End: Complemental strand, 26119087 - 26119032
Alignment:
Q |
103 |
cttttggatgcaataaaagatgaccaaaactttatggttggattgcatggtatggg |
158 |
Q |
|
|
|||||||||||||||||||||||| |||| |||||||||||||||||| ||||| |
|
|
T |
26119087 |
cttttggatgcaataaaagatgacagtaactatatggttggattgcatgggatggg |
26119032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 103 - 181
Target Start/End: Complemental strand, 26185546 - 26185468
Alignment:
Q |
103 |
cttttggatgcaataaaagatgaccaaaactttatggttggattgcatggtatgggagggactggtaagacaacattgg |
181 |
Q |
|
|
|||||||||||| ||||||||||| |||| |||||||||||||||||| ||||| || ||||||| || ||||||| |
|
|
T |
26185546 |
cttttggatgcactaaaagatgacagcaactatatggttggattgcatggaatggggggttctggtaaaactacattgg |
26185468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 103 - 181
Target Start/End: Complemental strand, 26214153 - 26214075
Alignment:
Q |
103 |
cttttggatgcaataaaagatgaccaaaactttatggttggattgcatggtatgggagggactggtaagacaacattgg |
181 |
Q |
|
|
|||||||||||| ||||||||||| |||| |||||||||||||||||| ||||| || ||||||| || ||||||| |
|
|
T |
26214153 |
cttttggatgcactaaaagatgacagcaactatatggttggattgcatggaatggggggttctggtaaaactacattgg |
26214075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 103 - 181
Target Start/End: Complemental strand, 26241351 - 26241273
Alignment:
Q |
103 |
cttttggatgcaataaaagatgaccaaaactttatggttggattgcatggtatgggagggactggtaagacaacattgg |
181 |
Q |
|
|
|||||||||||| ||||||| ||| | |||| |||||||||||||||||| ||||| || |||| || |||||||||| |
|
|
T |
26241351 |
cttttggatgcactaaaagacgacaacaactatatggttggattgcatgggatggggggtgctggaaaaacaacattgg |
26241273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 296
Target Start/End: Original strand, 28045786 - 28045826
Alignment:
Q |
256 |
cctgatatcagaaagattcaagataatattgctgtcccctt |
296 |
Q |
|
|
|||||||||||||||||||||||| |||||||||| ||||| |
|
|
T |
28045786 |
cctgatatcagaaagattcaagatgatattgctgtaccctt |
28045826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 256 - 288
Target Start/End: Original strand, 11407161 - 11407193
Alignment:
Q |
256 |
cctgatatcagaaagattcaagataatattgct |
288 |
Q |
|
|
|||||||||||||||||||||||| |||||||| |
|
|
T |
11407161 |
cctgatatcagaaagattcaagatgatattgct |
11407193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 103 - 181
Target Start/End: Complemental strand, 26147082 - 26147007
Alignment:
Q |
103 |
cttttggatgcaataaaagatgaccaaaactttatggttggattgcatggtatgggagggactggtaagacaacattgg |
181 |
Q |
|
|
||||| |||||| ||||||||||| | |||| ||| |||||||||||| |||||||| ||||||| |||||||||| |
|
|
T |
26147082 |
cttttcgatgcactaaaagatgacaacaactatat---tggattgcatgggatgggaggttctggtaaaacaacattgg |
26147007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University