View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10085_low_8 (Length: 289)

Name: NF10085_low_8
Description: NF10085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10085_low_8
NF10085_low_8
[»] chr7 (2 HSPs)
chr7 (1-225)||(35725582-35725806)
chr7 (69-127)||(35702573-35702629)


Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 35725806 - 35725582
Alignment:
1 attttatttttacaaattctctgggtgtgttttgcaataaaacttgttccgaaaaattaagtgtaaaataagaacaccgtgcaaccatcccagacagggt 100  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||    
35725806 attttatttttacaaattctctgggtgtgttttgcaataaaaattgttccgaaaaattaagtgtaaaaaaagaacaccgtgcaaccaccccagacagcgt 35725707  T
101 gtgtgtctgagaatgatcatctacagcgcctgggataatttatttcttggtggataatttatttatatgtatgcaaagaaattataaaatggaaagaaat 200  Q
    ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35725706 gtgtgtctgagaacgatcatctacagcgcgtgggataatttatttcttggtggataatttatttatatgtatgcaaagaaattataaaatggaaagaaat 35725607  T
201 ttcctatttagtgggataaggcttg 225  Q
    | || | ||||||||||||||||||    
35725606 tccccacttagtgggataaggcttg 35725582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 69 - 127
Target Start/End: Complemental strand, 35702629 - 35702573
Alignment:
69 taagaacaccgtgcaaccatcccagacagggtgtgtgtctgagaatgatcatctacagc 127  Q
    |||||||||| |||||||| ||||||||| ||||||  ||||||| |||||||||||||    
35702629 taagaacaccatgcaaccaccccagacagcgtgtgt--ctgagaacgatcatctacagc 35702573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University