View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10085_low_8 (Length: 289)
Name: NF10085_low_8
Description: NF10085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10085_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 35725806 - 35725582
Alignment:
Q |
1 |
attttatttttacaaattctctgggtgtgttttgcaataaaacttgttccgaaaaattaagtgtaaaataagaacaccgtgcaaccatcccagacagggt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| ||||||||| || |
|
|
T |
35725806 |
attttatttttacaaattctctgggtgtgttttgcaataaaaattgttccgaaaaattaagtgtaaaaaaagaacaccgtgcaaccaccccagacagcgt |
35725707 |
T |
 |
Q |
101 |
gtgtgtctgagaatgatcatctacagcgcctgggataatttatttcttggtggataatttatttatatgtatgcaaagaaattataaaatggaaagaaat |
200 |
Q |
|
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35725706 |
gtgtgtctgagaacgatcatctacagcgcgtgggataatttatttcttggtggataatttatttatatgtatgcaaagaaattataaaatggaaagaaat |
35725607 |
T |
 |
Q |
201 |
ttcctatttagtgggataaggcttg |
225 |
Q |
|
|
| || | |||||||||||||||||| |
|
|
T |
35725606 |
tccccacttagtgggataaggcttg |
35725582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 69 - 127
Target Start/End: Complemental strand, 35702629 - 35702573
Alignment:
Q |
69 |
taagaacaccgtgcaaccatcccagacagggtgtgtgtctgagaatgatcatctacagc |
127 |
Q |
|
|
|||||||||| |||||||| ||||||||| |||||| ||||||| ||||||||||||| |
|
|
T |
35702629 |
taagaacaccatgcaaccaccccagacagcgtgtgt--ctgagaacgatcatctacagc |
35702573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University