View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10086_low_3 (Length: 352)
Name: NF10086_low_3
Description: NF10086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10086_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 245 - 332
Target Start/End: Complemental strand, 9716148 - 9716060
Alignment:
| Q |
245 |
aatgagagtgattgtgaaaaacggtacttacatgagataaattact-aattaattaaattattcttttagtcaatatatcccgcctata |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9716148 |
aatgagagtgattgtgaaaaacggtacttacatgagataaattagtaaattaattaaattattcttttagtcaatatatcccgcctata |
9716060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 9716400 - 9716309
Alignment:
| Q |
1 |
taaacatgattaactaatatcatcttcttcattccctcgtttaactctaagcatcttccattcttgcatcttgtgcttttaattactctcga |
92 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
9716400 |
taaacatgattaactaatatcatgttcttcattctctcgtttaactctaagcatcttccattcttgtatcttatgcttttaattactctcga |
9716309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University