View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10086_low_4 (Length: 287)
Name: NF10086_low_4
Description: NF10086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10086_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 16 - 279
Target Start/End: Original strand, 48165664 - 48165928
Alignment:
| Q |
16 |
caccttattataatcattaaccatttaccgattataattaaatacatatttgaactgtgct-agctatctaatttgttgttgaaacttgatgttaaattt |
114 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48165664 |
caccttcttataatcattaaccatttaccgattataattaaatacatatttgaactgtgcttagctatctaatttgttgttgaaacttgatgttaaattt |
48165763 |
T |
 |
| Q |
115 |
gcgtgtctaaaattatataactctttccatttggtgcaggtacatgtttattggatttcaatgcataccaaaatgaatatatgccttttggtgaatgtgg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48165764 |
gcgtgtctaaaattatataactctttccatttggtgcaggtacatgtttattggatttcaatgcataccaaaatgaatatatgccttttggtgaatgtgg |
48165863 |
T |
 |
| Q |
215 |
gggtgcaaaagaggatataaccaaatggggcagtggcagtgatggtttcccaactactctctgct |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48165864 |
gggtgcaaaagaggatataaccaaatggggcagtggcagtgatggtttcccaactactctctgct |
48165928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University