View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10086_low_7 (Length: 240)
Name: NF10086_low_7
Description: NF10086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10086_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 164
Target Start/End: Complemental strand, 19272102 - 19271956
Alignment:
| Q |
18 |
aaaataaccttattaagagtaatatgatgaaatgcaccataatcgagaaccaatagagtaagtgaaggtaactggaaattgcaagcaactaatttaccaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19272102 |
aaaataaccttattaagagtaatatgatgaaatgcaccataatcgagaaccaatagagtaagtgaaggtaactggaaattgcaagcaactaatttaccaa |
19272003 |
T |
 |
| Q |
118 |
ggtgtgccccttaaataacaggtcctgagttctggagatactttacc |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19272002 |
ggtgtgccccttaaataacaggtcctgagttctgaagatactttacc |
19271956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University