View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10086_low_9 (Length: 218)
Name: NF10086_low_9
Description: NF10086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10086_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 31881258 - 31881446
Alignment:
| Q |
1 |
ataataatactaggtaggagacaagggtatagtggaaataacatccaaaaattgcttctcttccctgtttcttcacacatgagagaagaaggaaaaatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||| | |
|
|
| T |
31881258 |
ataataatactaggtaggagacaagggtttagtgggaataacatccaaaaattgcctctcttccctgtttcttcgcacatgagagaagaagaaaaaacat |
31881357 |
T |
 |
| Q |
101 |
gtgggacccatagtacttttatatgttctgtctcccccatttctcttctgcaccaaacaatagaaaaaccattcttctctcgttattctctccc |
194 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
31881358 |
gtgggatccatagtactttta-----tctgtctcccccatttctcttctgcaccaaacgatagaaaaaccattcttctctccttattctctccc |
31881446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 9 - 192
Target Start/End: Complemental strand, 9211966 - 9211788
Alignment:
| Q |
9 |
actaggtaggagacaagggtatagtggaaataacatccaaaaattgcttctcttccctgtttcttcacacatgagagaagaaggaaaaataggtgggacc |
108 |
Q |
| |
|
|||||| |||||||||||| |||||| | |||||||||||||||||||||||||||| ||||||| ||||||| |||| || |||||||||||||||| |
|
|
| T |
9211966 |
actaggcaggagacaagggcatagtgagagtaacatccaaaaattgcttctcttccctctttcttcgcacatgaacgaagtagaaaaaataggtgggacc |
9211867 |
T |
 |
| Q |
109 |
catagtacttttatatgttctgtctcccccatttctcttctgcaccaaacaatagaaaaaccattcttctctcgttattctctc |
192 |
Q |
| |
|
|||||||||||||| || |||||| ||||||||| ||||||||| | ||||||| |||||||||||| |||||||||| |
|
|
| T |
9211866 |
catagtacttttat-----ctctctccctaatttctcttttgcaccaaatgagagaaaaatcattcttctctccttattctctc |
9211788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 9 - 113
Target Start/End: Complemental strand, 36183460 - 36183356
Alignment:
| Q |
9 |
actaggtaggagacaagggtatagtggaaataacatccaaaaattgcttctcttccctgtttcttcacacatgagagaagaaggaaaaataggtgggacc |
108 |
Q |
| |
|
||||||||||| ||||||| ||| ||| |||||||||||||| |||||||||||||| |||||| ||||||||| |||||| ||||| | |||||||| |
|
|
| T |
36183460 |
actaggtaggaaacaagggcataatgggaataacatccaaaacttgcttctcttcccactttctttgcacatgagaaaagaagaaaaaaaacgtgggacc |
36183361 |
T |
 |
| Q |
109 |
catag |
113 |
Q |
| |
|
||||| |
|
|
| T |
36183360 |
catag |
36183356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University