View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10087_low_5 (Length: 235)
Name: NF10087_low_5
Description: NF10087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10087_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 15 - 226
Target Start/End: Original strand, 53635026 - 53635237
Alignment:
Q |
15 |
actatatttgttgacaggaccagcgttgtgcaagtgtaacaaggctcttagcacaaaggtctcaaatttaaagaatcctcaaaatttgcaaaaataaaac |
114 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
T |
53635026 |
actatatttgttgacaggacccgcgttgtgcaagtgtaacaaggctcttggcacaaaggtctcaaatttagagaatcctcaaaatttacaaaaataaaac |
53635125 |
T |
 |
Q |
115 |
ttatatatactgacaaaatctctcaccaaatatcannnnnnnatagttaaaagtctataagacaacagttttgttgcctattcaagtagcttttcccctt |
214 |
Q |
|
|
||||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
53635126 |
ttatatatactgacaaaatatgtcaccaaatatcgtttttctatagttaaaagtctataagacaacaattttgttgcctattcaagtagcttttcccctt |
53635225 |
T |
 |
Q |
215 |
gtttttcctttg |
226 |
Q |
|
|
|||||||||||| |
|
|
T |
53635226 |
gtttttcctttg |
53635237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University