View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10088_high_10 (Length: 243)
Name: NF10088_high_10
Description: NF10088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10088_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 30994663 - 30994436
Alignment:
| Q |
1 |
attagaaggattggtttttggtctgaatcttatggactccacactggtgtggaatctcctaatcattcaaatttaagaaaagaattatatggtgtcatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30994663 |
attagaaggattggtttttggtctgaatcttatggactccacactggtgtggaatctcctaatcattcaaatttaagaaaaggattatatggtgtcatat |
30994564 |
T |
 |
| Q |
101 |
ggcctggtcaaacaactcataccccgcgtggttgggttttcgctagcaatggaagacacttgaaagttggtgtgccaattaaaattagttaccatgaact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30994563 |
ggcctggtcaaacaactcataccccgcgtggttgggttttcgctagcaatggaagacgcttgaaagttggtgtgccgcttaaaattagttaccatgaact |
30994464 |
T |
 |
| Q |
201 |
tgtgtcaagaattaagggttctgatatg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
30994463 |
tgtgtcaagaattaagggttctgatatg |
30994436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University