View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10088_high_14 (Length: 227)
Name: NF10088_high_14
Description: NF10088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10088_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 686676 - 686599
Alignment:
| Q |
8 |
ataacaggaaagaatgaaccttttatgtaccgatccaaagaatctctttggtccccatctcgaaagcttgactacatg |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
686676 |
ataacaggaaagaatgaaccttttatgtaccgatccaaggaatctctttggtccccatctcgaaagcttgactacatg |
686599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 84 - 124
Target Start/End: Complemental strand, 686577 - 686537
Alignment:
| Q |
84 |
tgtgtgagtaataagagtatagttcagattcagaccactta |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
686577 |
tgtgtgagtaataagagtatagttcagattcagaccactta |
686537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University