View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10088_high_6 (Length: 321)
Name: NF10088_high_6
Description: NF10088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10088_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 7 - 312
Target Start/End: Complemental strand, 40568723 - 40568419
Alignment:
| Q |
7 |
gatgtttcttgtccgtattttttgtgccgtgttattattggtgccagcttgaaaataagtccccccttcaagcactttttctttatcagcctctatatcg |
106 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40568723 |
gatgtttcttgtccatattttttgtgccgtgttattattggtgccagcttgaaaataagtccccccttcaagcactttttctttatcagcctctatatcg |
40568624 |
T |
 |
| Q |
107 |
aactgtaccatgaaaaatccatggccaatatctacaatctcaaaaccaccagttagtttccataacgccttgacatgctccctcgtcgtaacataaccaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40568623 |
aactgtaccatgaaaaatccatggccaatatctacaatctcaaaaccaccagttagtttccataacgccttgacatgctcc--cgtcgtaacataaccaa |
40568526 |
T |
 |
| Q |
207 |
tgaatttacctagaagtattatgatgatgatagcatcattgcaaggtttgcacaattctgatataaccttatcatca----aagtatgtgttccctcccc |
302 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40568525 |
tgaatttacctagaaatatt---atgatcatagcatcattgcaaggtttgcacaattctgatataaccttatcatcaaattaagtatgtgttccctcccc |
40568429 |
T |
 |
| Q |
303 |
tccccctatg |
312 |
Q |
| |
|
|||||||||| |
|
|
| T |
40568428 |
tccccctatg |
40568419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University