View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10088_low_11 (Length: 247)
Name: NF10088_low_11
Description: NF10088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10088_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 42938995 - 42939187
Alignment:
| Q |
1 |
catgtgtgatttaaaataaaataggcgctaaattcatactttcgtataagacactttaaatcttaagaacgaccggataatatttatattaatatgagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42938995 |
catgtgtgatttaaaataaaataggcgtcaaattcatacttttgtataagacactttaaatcttaaggacgaccggataatatttatattaatatgagat |
42939094 |
T |
 |
| Q |
101 |
ttaggtaattttattaatatctaacaagtacgaatgcccatggataagattaccattatctccgtctttgtattaattaactcatagatagtt |
193 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42939095 |
ttgggtaattttattaatatctaacaagtacgaatgccgatggataagattaccattatctccgcctttgtattaattaactcatagatagtt |
42939187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 175 - 243
Target Start/End: Original strand, 42939197 - 42939265
Alignment:
| Q |
175 |
aattaactcatagatagttgaaatatctatttctttaatccgtgaatatctgctaagatacctatgctt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42939197 |
aattaactcatagatagttgaaatatctatttctttaatccgtgaatatctgttaagatacctatgctt |
42939265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University