View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10088_low_15 (Length: 230)
Name: NF10088_low_15
Description: NF10088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10088_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 30953282 - 30953082
Alignment:
| Q |
16 |
cagagaagaataaaactcataaaaatttcattgagacaacaaacaataacaacaacgcataaattctcatactttatttcttgtgtactactttgcttca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30953282 |
cagagaagaataaaactcataaaaatttcattgagacaacaaacaataacaacaacgcataaattctcatactttatttcttgtgtactactttgcttca |
30953183 |
T |
 |
| Q |
116 |
atttcagttttgcatcattacgaaaatttgacccatagccccaattcttatactgtatgttctctccctctcaatttcaattttgcatcattgagaaatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30953182 |
atttcagttttgcatcattacgaaaatttgacccatagccccaattcttatactgtatgttctctccctctcaatttcaattttgcatcattgagaaatt |
30953083 |
T |
 |
| Q |
216 |
t |
216 |
Q |
| |
|
| |
|
|
| T |
30953082 |
t |
30953082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 113 - 161
Target Start/End: Complemental strand, 30953112 - 30953064
Alignment:
| Q |
113 |
tcaatttcagttttgcatcattacgaaaatttgacccatagccccaatt |
161 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
30953112 |
tcaatttcaattttgcatcattgagaaattttgacccataaccccaatt |
30953064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University