View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10088_low_15 (Length: 230)

Name: NF10088_low_15
Description: NF10088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10088_low_15
NF10088_low_15
[»] chr6 (2 HSPs)
chr6 (16-216)||(30953082-30953282)
chr6 (113-161)||(30953064-30953112)


Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 30953282 - 30953082
Alignment:
16 cagagaagaataaaactcataaaaatttcattgagacaacaaacaataacaacaacgcataaattctcatactttatttcttgtgtactactttgcttca 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30953282 cagagaagaataaaactcataaaaatttcattgagacaacaaacaataacaacaacgcataaattctcatactttatttcttgtgtactactttgcttca 30953183  T
116 atttcagttttgcatcattacgaaaatttgacccatagccccaattcttatactgtatgttctctccctctcaatttcaattttgcatcattgagaaatt 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30953182 atttcagttttgcatcattacgaaaatttgacccatagccccaattcttatactgtatgttctctccctctcaatttcaattttgcatcattgagaaatt 30953083  T
216 t 216  Q
    |    
30953082 t 30953082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 113 - 161
Target Start/End: Complemental strand, 30953112 - 30953064
Alignment:
113 tcaatttcagttttgcatcattacgaaaatttgacccatagccccaatt 161  Q
    ||||||||| ||||||||||||  |||| ||||||||||| ||||||||    
30953112 tcaatttcaattttgcatcattgagaaattttgacccataaccccaatt 30953064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University