View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10088_low_16 (Length: 227)

Name: NF10088_low_16
Description: NF10088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10088_low_16
NF10088_low_16
[»] chr7 (2 HSPs)
chr7 (8-85)||(686599-686676)
chr7 (84-124)||(686537-686577)


Alignment Details
Target: chr7 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 686676 - 686599
Alignment:
8 ataacaggaaagaatgaaccttttatgtaccgatccaaagaatctctttggtccccatctcgaaagcttgactacatg 85  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
686676 ataacaggaaagaatgaaccttttatgtaccgatccaaggaatctctttggtccccatctcgaaagcttgactacatg 686599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 84 - 124
Target Start/End: Complemental strand, 686577 - 686537
Alignment:
84 tgtgtgagtaataagagtatagttcagattcagaccactta 124  Q
    |||||||||||||||||||||||||||||||||||||||||    
686577 tgtgtgagtaataagagtatagttcagattcagaccactta 686537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University