View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10089_high_6 (Length: 212)
Name: NF10089_high_6
Description: NF10089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10089_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 69 - 193
Target Start/End: Complemental strand, 36027449 - 36027325
Alignment:
| Q |
69 |
gactgttttcaaacaataatatatttatcaaactcattgctgaaattagacagggatgatatgataaataagagatatcatctgagtagggtaagattgg |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36027449 |
gactgttttcaaacaataatatatttatcaaactcattgctgaaattagacagggatgatatgataaataagagatatcatctgggtagggtaagattgg |
36027350 |
T |
 |
| Q |
169 |
acgcactaatatcgctggtcatgag |
193 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36027349 |
acgcactaatatcgctggtcatgag |
36027325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 73 - 193
Target Start/End: Original strand, 16931801 - 16931921
Alignment:
| Q |
73 |
gttttcaaacaataatatatttatcaaactcattgctgaaattagacagggatgatatgataaataagagatatcatctgagtaggg-taagattggacg |
171 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | |||| |||||||||||||||||||||| || |||| |||||| | |||||| |||||||||||| |
|
|
| T |
16931801 |
gttttcaaacaatattatatttatcaaactcatcgttgaa-ttagacagggatgatatgataattatgagaaatcatcggggtaggggtaagattggacg |
16931899 |
T |
 |
| Q |
172 |
cactaatatcgctggtcatgag |
193 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
16931900 |
cactaatatcgctggtcatgag |
16931921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University