View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10089_low_14 (Length: 222)
Name: NF10089_low_14
Description: NF10089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10089_low_14 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 3522575 - 3522781
Alignment:
| Q |
17 |
acacacttattatgataagaaaaaattaacaacactgccatctccaccgtgtgcaaaagccaattgaaattgattgggaacagaaaattcatatcctaat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3522575 |
acacacttattatgataagaaaaaattaacaacgctgccacctccaccgtgtgcaacagccaattgaaattgattgggaacagaaaattcatatcctaat |
3522674 |
T |
 |
| Q |
117 |
tatgtgtgttttagttaaatcaaattgggaatcaattctttaatcgaccgagagtgagaagcaaggacctttggaatgagag-gaaaaaatagaaggaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3522675 |
tatgtgtgttttagttaaatcaaattgggaatcaattctttaatcgaccgagagtgagaagcaaggacctttggaatgagagtaaaaaaatagaaggaaa |
3522774 |
T |
 |
| Q |
216 |
aatagtt |
222 |
Q |
| |
|
||||||| |
|
|
| T |
3522775 |
aatagtt |
3522781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University