View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10089_low_4 (Length: 445)
Name: NF10089_low_4
Description: NF10089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10089_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 205 - 444
Target Start/End: Original strand, 40292009 - 40292248
Alignment:
| Q |
205 |
ggctcaaggagggacagaaattgaatttaagaaagtaacaacaaaaattgcattagagaaacagaaacaaactacacaccaggtaccatggaacctcttt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40292009 |
ggctcaaggagggacagaaattgaatttaagaaaataacaacaaaaattgcattagagaaacagaaacaaactacacaccaggtaccatggaacctcttt |
40292108 |
T |
 |
| Q |
305 |
tggaattgatgatatgagcctagaaggttgtgtccatgaaaaaacatcattcttgtcaaaaaagggatcagcataattgcatgtctttttgtgctcaata |
404 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
40292109 |
tggaattgatgatatgagcctagaatgctgtgtccatgaaaaaacatcattcttgtcaaaaaaggaatcagcataactgcatgtctttttgtgctcaata |
40292208 |
T |
 |
| Q |
405 |
gcacactcgcatttctcttttcgctcaatctttttaagat |
444 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40292209 |
gcacactcgcatttctcttttcgctcaacctttttaagat |
40292248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 40291787 - 40291909
Alignment:
| Q |
1 |
ctaacaatctcaccttttcatcttcgagatagctcgatatttcagacggctcaaattttgatcctacagcaggtaatacaaaatcagtggcaccacatgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40291787 |
ctaacaatctcaccttttcatcttcgagatagctcgatatttcagacggctcaaattttgatccttcagcaggtaatacaaaatcagtggcaccacatgc |
40291886 |
T |
 |
| Q |
101 |
acacgatcagtcccgtcatcctt |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40291887 |
acacgatcagtcccgtcatcctt |
40291909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University