View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10089_low_9 (Length: 269)
Name: NF10089_low_9
Description: NF10089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10089_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 86 - 262
Target Start/End: Complemental strand, 43074896 - 43074720
Alignment:
| Q |
86 |
gtgctgaatgtgttgaagtttaatgtaatgtttgataaagcatataataatagtgaaaaagaaaggtttggatcnnnnnnnnnggccgtccttattctca |
185 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
43074896 |
gtgctgaatgtgttgaagtttaatataatgtttgataaagcatataataatagagaaaaagaaagatttggatctttttttttggccgtccttattctca |
43074797 |
T |
 |
| Q |
186 |
ttgttttttagtggccagtgatgtttttagtcttcattcattcttccatagcaatgaaatgatatagttgacctatg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43074796 |
ttgttttttagtggccagtgatgtttttagtcttcattcattcttccatagcaatgaaatgatatagttgacctatg |
43074720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 47
Target Start/End: Complemental strand, 43074965 - 43074935
Alignment:
| Q |
17 |
tttagttagactagagagtactagtacatta |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43074965 |
tttagttagactagagagtactagtacatta |
43074935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University