View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1008_low_2 (Length: 306)

Name: NF1008_low_2
Description: NF1008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1008_low_2
NF1008_low_2
[»] chr3 (2 HSPs)
chr3 (139-279)||(49290992-49291123)
chr3 (1-85)||(49290856-49290940)


Alignment Details
Target: chr3 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 139 - 279
Target Start/End: Original strand, 49290992 - 49291123
Alignment:
139 taatattcaaaacatgtagaaatgacaatgatataattaatttataattccaaaataaaatgcaatacgatcaatacatgccaacaaccaagatagcaat 238  Q
    ||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49290992 taatattcaaaacatgtagaaatgacaatgat---------ttataattccaaaataaaatgcaatacgatcaatacatgccaacaaccaagatagcaat 49291082  T
239 caactctctcagaaaattgaagattcatcaacatgaatttg 279  Q
    |||||||||||||||||||||||||||||||||||||||||    
49291083 caactctctcagaaaattgaagattcatcaacatgaatttg 49291123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 49290856 - 49290940
Alignment:
1 atatctttatttgttaagttctttgcctgcactagttttacatctagtgttccaacgggtttcaattctaggttactgtcagatg 85  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49290856 atatctttatttgataagttctttgcctgcactagttttacatctagtgttccaacgggtttcaattctaggttactgtcagatg 49290940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University