View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10091_low_9 (Length: 248)
Name: NF10091_low_9
Description: NF10091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10091_low_9 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 8 - 248
Target Start/End: Complemental strand, 49163023 - 49162783
Alignment:
Q |
8 |
gcagagatggtaagaaaggaaatgatggaccaaggggtgaagaaagtgcctggctgtagttggattgagataagaaatgtggtgactgcatttgtatcag |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49163023 |
gcagagatggtaagaaaggaaatgatggaccaaggggtgaagaaagtgcctggctgtagttggattgagataagaaatgtggtgactgcatttgtatcag |
49162924 |
T |
 |
Q |
108 |
gaaataatttatatccttgcatggctgatatatctaagatactatacttccttgaattagaaatgagacacacacgacccattcattttgatattgaatg |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
T |
49162923 |
gaaataatttatatccttgcatggctgatatatctaagatactatacttccttgaattagaaatgagacacacacggcccattaattttgatattgaatg |
49162824 |
T |
 |
Q |
208 |
atcttttataaaccagtgatgcatttatgtgaaataatttt |
248 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
49162823 |
atcttttataaaccagagatgcatttatgtgaaataatttt |
49162783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University