View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_high_42 (Length: 246)
Name: NF10092A_high_42
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_high_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 32804060 - 32803836
Alignment:
| Q |
1 |
tctttcacttcgtcatgttaccgctcccgcagcaaagcctccggcgtcttcccgctggcactaagcttccaacgatgctcaccggtcagtctctaaccgt |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32804060 |
tctttcacttcgtcatcttaccgctcccgcagcaaagcctccggcgtcttcccgctggcactaagcttccaacgatgctcaccggtcagtcgctaaccgt |
32803961 |
T |
 |
| Q |
101 |
cactacctcttcctccgatcgcgtgacatctgttaacaatatcaaaatcattggatctccgatctacgacaatggagttctctttgtttacggaatcgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32803960 |
cactacctcttcctccgatcgcgtgacatctgttaacaatatcaaaatcattggatctccgatctacgacaatggagttctctttgtttacggaatagat |
32803861 |
T |
 |
| Q |
201 |
agattcttggatcctagttttcagt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32803860 |
agattcttggatcctagttttcagt |
32803836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 6 - 225
Target Start/End: Complemental strand, 49028869 - 49028650
Alignment:
| Q |
6 |
cacttcgtcatgttaccgctcccgcagcaaagcctccggcgtcttcccgctggcactaagcttccaacgatgctcaccggtcagtctctaaccgtcacta |
105 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| | || ||||||||||| ||| |||||||||| |||||||| ||||||||||| ||||||||||||| |
|
|
| T |
49028869 |
cacttcgtcatgttaccgcttccgcagcaaagcttacgccgtcttcccgccggcgctaagcttccgacgatgcttaccggtcagtcgctaaccgtcacta |
49028770 |
T |
 |
| Q |
106 |
cctcttcctccgatcgcgtgacatctgttaacaatatcaaaatcattggatctccgatctacgacaatggagttctctttgtttacggaatcgatagatt |
205 |
Q |
| |
|
| || | ||||||||||||||| ||||||||||||||||| |||| ||| | |||||||||||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
49028769 |
catcattctccgatcgcgtgacctctgttaacaatatcaagatcaacggaacgccgatctacgacgacggagttcttcttgtttacggaatcgatagatt |
49028670 |
T |
 |
| Q |
206 |
cttggatcctagttttcagt |
225 |
Q |
| |
|
|| ||||||| |||||||| |
|
|
| T |
49028669 |
tttcgatcctaattttcagt |
49028650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University