View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_high_44 (Length: 236)
Name: NF10092A_high_44
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 8 - 146
Target Start/End: Complemental strand, 32804655 - 32804516
Alignment:
| Q |
8 |
ttggtgttagacataactttaatctcacacgttcttgttagatagttggatacacattcattttttc-gtaatttttgttgatattaatctttagtctag |
106 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32804655 |
ttggtgttagacataactttaatctcatacgtccttgttagatagttggatacacatttattttttttgtaatttttgttgatattaatctttagtctag |
32804556 |
T |
 |
| Q |
107 |
aaaatttaattgtaaaatagttattgtaattttaacttat |
146 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32804555 |
aaaatttaattgtaaaatagttattgcaattttaacttat |
32804516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 230
Target Start/End: Complemental strand, 32804446 - 32804400
Alignment:
| Q |
184 |
ttatggttggaagagtaaaaatggcaacgtggcaacaaacagataca |
230 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
32804446 |
ttatggttggaagagttaaaatgccaacgtggcaacaaacagataca |
32804400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University