View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10092A_high_44 (Length: 236)

Name: NF10092A_high_44
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10092A_high_44
NF10092A_high_44
[»] chr4 (2 HSPs)
chr4 (8-146)||(32804516-32804655)
chr4 (184-230)||(32804400-32804446)


Alignment Details
Target: chr4 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 8 - 146
Target Start/End: Complemental strand, 32804655 - 32804516
Alignment:
8 ttggtgttagacataactttaatctcacacgttcttgttagatagttggatacacattcattttttc-gtaatttttgttgatattaatctttagtctag 106  Q
    ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |||||||  ||||||||||||||||||||||||||||||||    
32804655 ttggtgttagacataactttaatctcatacgtccttgttagatagttggatacacatttattttttttgtaatttttgttgatattaatctttagtctag 32804556  T
107 aaaatttaattgtaaaatagttattgtaattttaacttat 146  Q
    |||||||||||||||||||||||||| |||||||||||||    
32804555 aaaatttaattgtaaaatagttattgcaattttaacttat 32804516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 230
Target Start/End: Complemental strand, 32804446 - 32804400
Alignment:
184 ttatggttggaagagtaaaaatggcaacgtggcaacaaacagataca 230  Q
    |||||||||||||||| |||||| |||||||||||||||||||||||    
32804446 ttatggttggaagagttaaaatgccaacgtggcaacaaacagataca 32804400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University