View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_high_51 (Length: 223)
Name: NF10092A_high_51
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10092A_high_51 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 9 - 223
Target Start/End: Original strand, 33119722 - 33119938
Alignment:
Q |
9 |
agatgaatcaaattgtggcttctgtgcttccaccgatagggtaaacaaagtagtttaaatttattatgctctt--atatattcattgttgttaagagctt |
106 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
T |
33119722 |
agatgaatcaaattgtggcttctgtgattccaccgataaggtaaacaaagtagtttaaatttattatgctcttgtatatattcatcgttgttaagagctc |
33119821 |
T |
 |
Q |
107 |
ttatacataatcttgtatcgaatgttggttttgcagctaaaaccaggggcatgcttaatccaagatgacgcgtctaaggagcgttgcgaatcacagcata |
206 |
Q |
|
|
||||||||||||||||||| |||||||| ||||||||||||||| ||||||| |||||||||||| ||||| ||||||||||| |||| |||||| || | |
|
|
T |
33119822 |
ttatacataatcttgtatcaaatgttgggtttgcagctaaaaccgggggcatacttaatccaagacgacgcatctaaggagcgctgcgcatcacaacaca |
33119921 |
T |
 |
Q |
207 |
gggattggtacacacaa |
223 |
Q |
|
|
| ||||||||||||||| |
|
|
T |
33119922 |
gagattggtacacacaa |
33119938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University