View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_high_52 (Length: 213)
Name: NF10092A_high_52
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_high_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 53 - 191
Target Start/End: Complemental strand, 38207799 - 38207661
Alignment:
| Q |
53 |
cagagacagtacgtttttggcgtgagactgagtctgagtgtgctaaaaacactcttaaaactttccctctttcgtcttccactctttttcctttacactt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38207799 |
cagagacagtacgtttttggcgtgagactgagtctgagtgtgctaaaaacactcttaaaactttccctctttcgtcttccactctttttcctttacactt |
38207700 |
T |
 |
| Q |
153 |
catttcattctataaattgcaactccactacatttttct |
191 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38207699 |
catttcattctataaattgctactccactacatttttct |
38207661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University