View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_high_9 (Length: 389)
Name: NF10092A_high_9
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10092A_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 5e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 100 - 212
Target Start/End: Original strand, 42590891 - 42591004
Alignment:
Q |
100 |
taatggcaatcatattgggtagtgagcatagtggtgataacagaattgaagaagggcattc-cctatggaatagtgtggttaaagataatttctaactgt |
198 |
Q |
|
|
|||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||| || |
|
|
T |
42590891 |
taatggcagtcatgttgggtagtgagcatagtggtgataacagaattgaagaagggccttctcctatggaatagtgtggttgaagataatttctaaccgt |
42590990 |
T |
 |
Q |
199 |
aatacaagctggtg |
212 |
Q |
|
|
|||||||||||||| |
|
|
T |
42590991 |
aatacaagctggtg |
42591004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 358
Target Start/End: Original strand, 42591181 - 42591288
Alignment:
Q |
249 |
atgtttcgtgtacatcgttttaacaccattctatagacattatgttgaaatgtcgtagcatgaattgaaacggtggcttactatttgcgttgcaatgaaa |
348 |
Q |
|
|
||||||| |||| ||||||||||||||||| ||| ||| | ||||||||| | ||||||||||| |||| | |||||||||||| |||| ||||||| |
|
|
T |
42591181 |
atgtttcttgtatatcgttttaacaccattacatacacagt--gttgaaatgacctagcatgaattcaaacaatagcttactatttgtgttgaaatgaaa |
42591278 |
T |
 |
Q |
349 |
ctttttctat |
358 |
Q |
|
|
|||||||||| |
|
|
T |
42591279 |
ctttttctat |
42591288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University