View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_107 (Length: 299)
Name: NF10092A_low_107
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_107 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 34818918 - 34818633
Alignment:
| Q |
1 |
aatgcttctgaccacataagtcgttttggattaatggcagaagcattgccccacctataagttctagaaggcaagttcaaaaaattctcttgtgatttaa |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34818918 |
aatgcttctgaccacataagttgttttggattaatggcagaagcgttgccccacctataagttctagaaggcaagttcaaaaaattctcttgtgatttaa |
34818819 |
T |
 |
| Q |
101 |
ttccaaaaggtgttcggaacacttccttttcttcaaactgcatgttctttagcacctcttgtgaaactccatgattcacaacttggaaaaaaccccattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34818818 |
ttccaaaaggtgttcggaacacttccttttcttcaaactgcatgttctttagcacctcttgtgaaactccatgattcacaacttggaaaaaaccccattt |
34818719 |
T |
 |
| Q |
201 |
tctagcagcttcagtgatttctttcatgcattcttctctctcaagttggtcaagttttaaacgtttgagatcaattagaggtatct |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34818718 |
tctagcagcttcagtgatttctttcatgcattcttctctctcaagttggtcaagttttaaacgtttgagatcaattagaggtatct |
34818633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 190 - 239
Target Start/End: Original strand, 34847858 - 34847907
Alignment:
| Q |
190 |
aaaccccattttctagcagcttcagtgatttctttcatgcattcttctct |
239 |
Q |
| |
|
||||||||||| |||||||||||| | |||||||||||||| |||||||| |
|
|
| T |
34847858 |
aaaccccatttactagcagcttcacttatttctttcatgcactcttctct |
34847907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University