View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_108 (Length: 298)
Name: NF10092A_low_108
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10092A_low_108 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 23 - 298
Target Start/End: Original strand, 28550887 - 28551162
Alignment:
Q |
23 |
cacatgcaccgtcccaacaaaaaggaaagtgaagtattattgatgtttaaaaattacaaggttcatgccatattaaacacatttcaataaaactgaatta |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28550887 |
cacatgcaccgtcccaacaaaaaggaaagtgaagtattattgatgtttaaaaatcacaaggttcatgccatattaaacacatttcaataaaactgaatta |
28550986 |
T |
 |
Q |
123 |
atgtgctagagactctatctcatcttcacgccaattgcgaatttcctctaagatcccagatggttgtcttgctggatcgttcgtagactcattcttgcac |
222 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
28550987 |
atgtgctagagaatctatctcatcttcacgccaattgcgaatttcctctaagatcccagatggttgtcttgttggatcgttcgtagactcattcttgcac |
28551086 |
T |
 |
Q |
223 |
ataagacatgatctcttttcacaggtgataatcttacacgagatattcatacggttcaatagattacgatgactcg |
298 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28551087 |
ataagacatgatctcttttcacaggtgataatcttacacgagatattcatacggttcaatagattacgatgactcg |
28551162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University