View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_125 (Length: 284)
Name: NF10092A_low_125
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_125 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 6 - 278
Target Start/End: Complemental strand, 37726338 - 37726066
Alignment:
| Q |
6 |
gtatggtgttgattgggttttcttgcagctcctaattagctagtttttaggtgtcagtgtttctagtactaggaaaatcttaatactaagacacctgaat |
105 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37726338 |
gtattgtgttgatacggttttcttgcagctcctaattagctagtttttaggtgtcagtgtttctagtactaggaaaatcttaatactaagacacctgaat |
37726239 |
T |
 |
| Q |
106 |
aatgaagtctttatatgaaggacacaattttctgctgtcaaggtgatttcgaaatgaacaagtcagtcaaagttgatttacttgggtaacaagtgtaatc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37726238 |
gatgaagtctttatatgaaggacacaattttctgctgtcaaggtgatttcgaaataaacaagtcagccaaagttgatttacttgggtaacaagtgtaatc |
37726139 |
T |
 |
| Q |
206 |
ttgtaagtaagttgtctatttagatactctagttaacatcctaggtggcagtagagtgttttatggtttaagt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37726138 |
ttgtaagtaagttgtctatttagatactctagttaacatcctaggtggcagtagagtgttttatggtttaagt |
37726066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University