View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_126 (Length: 283)
Name: NF10092A_low_126
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_126 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 158 - 268
Target Start/End: Original strand, 6976585 - 6976695
Alignment:
| Q |
158 |
atgtaggttggatatcgtcatatagattgtgctcaatattatggcaatgaaaaggaggtgaggtgttatgtatcattagtcctatcaatgtcaatatcgt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6976585 |
atgtaggttggatatcgtcatatagattgtgctcaatattatggcaatgaaaaggaggtgaggtgttatgtatcattagtcctatcaatgtcaatatcgt |
6976684 |
T |
|
| Q |
258 |
gtctgatgtcc |
268 |
Q |
| |
|
||||||||||| |
|
|
| T |
6976685 |
gtctgatgtcc |
6976695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 216
Target Start/End: Original strand, 6957129 - 6957183
Alignment:
| Q |
162 |
aggttggatatcgtcatatagattgtgctcaatattatggcaatgaaaaggaggt |
216 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6957129 |
aggttggttatcgtcatatagattgtgctcaaatttatggcaatgaaaaggaggt |
6957183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University