View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_129 (Length: 281)
Name: NF10092A_low_129
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_129 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 6 - 208
Target Start/End: Original strand, 9660202 - 9660410
Alignment:
| Q |
6 |
gtatcatagagaaagaaaggaactgtgactatgactcataaactactacatcagcttttgattaccagttattgcttacaaattgtgctttgttatttta |
105 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9660202 |
gtatcatagggaaagaaagcaactgtgactatgactcataaactactacatcagcttttggttaccagttattgctcacaaattgtgctttgttatttta |
9660301 |
T |
|
| Q |
106 |
ggaaaacatccactagagaaaaaggaaccataaattctgtct-------tgcttgtaactgagacatttggtctgccattgttcaagtaatcatattaat |
198 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||||| | ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9660302 |
ggaaaacatccacta-agaacaaggaaccataaattttgtcttagattgtacttgtaactgagacatttggtcttccattgttcaagtaatcatattaac |
9660400 |
T |
|
| Q |
199 |
aaaattgata |
208 |
Q |
| |
|
|||||||||| |
|
|
| T |
9660401 |
aaaattgata |
9660410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 221 - 281
Target Start/End: Original strand, 9660506 - 9660565
Alignment:
| Q |
221 |
ttgtttcataatcacaattcaaatggtaaaaagatagtaaaaatatttgataggttagagt |
281 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9660506 |
ttgtttcataatcacaattcaaatgataaaaagat-gtaaaaatatttgataggttagagt |
9660565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University