View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10092A_low_130 (Length: 281)

Name: NF10092A_low_130
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10092A_low_130
NF10092A_low_130
[»] chr3 (1 HSPs)
chr3 (12-276)||(55173885-55174149)


Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 12 - 276
Target Start/End: Complemental strand, 55174149 - 55173885
Alignment:
12 attcttgataaggcaagacatggaggtttgaacgttattcaaacttacgtgttttggaacgctcatgagccagagcaaggcaaggtatatgattaattaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55174149 attcttgataaggcaagacatggaggtttgaacgttattcaaacttacgtgttttggaacgctcatgagccagagcaaggcaaggtatatgattaattaa 55174050  T
112 atgacaaaattaatctcttgactcaatgtatggaacatttgattgtaaacttaatttgtttatcaaacgttatgcagttcaactttgaaggcaacaatga 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
55174049 atgacaaaattaatctcttgactcaatgtatggaacatttgattgtaaacttaatttgtttatcaaacgttatgcagttcaattttgaaggcaacaatga 55173950  T
212 tttggtgaagttcattaggcttgttcaatcaaaaggaatgtacgtgaccctcagggttggaccgt 276  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55173949 tttggtgaagttcattaggcttgttcaatcaaaaggaatgtacgtgaccctcagggttggaccgt 55173885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University