View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_134 (Length: 278)
Name: NF10092A_low_134
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_134 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 29584181 - 29583921
Alignment:
| Q |
1 |
aaatatcgtgtcaaatccttccatgtttgacaagtaaatttggtttgtactttatgttaacaaataattttgttatcttgaaaaagctttgattctacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29584181 |
aaatatcgtgtcaaatccttccatgtttgacaagtaaatttggtttgtactttatgttaacaaataattttgttatcttgaaaaagctttgattctacat |
29584082 |
T |
|
| Q |
101 |
ttgtggtgtgcatgtagagatgcagatttagttcaaagaattggagctgcaacatcacttgaacttagagcaagtggaactcactatacttgtgctcctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29584081 |
ttgtggtgtgcatgtagagatgcagatttagttcaaagaattggagctgcaatatcacttgaacttagagcaagtagaactcactatacttgtgctcctt |
29583982 |
T |
|
| Q |
201 |
gtgtggctgtagggcatcataaccaacttatgaatttgctacgctgattaactacagcttt |
261 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
29583981 |
gtgtggctgtaaggcatcataaccaacttctgaatttgctacgttgattaactacagcttt |
29583921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 113 - 191
Target Start/End: Original strand, 29610626 - 29610704
Alignment:
| Q |
113 |
tgtagagatgcagatttagttcaaagaattggagctgcaacatcacttgaacttagagcaagtggaactcactatactt |
191 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29610626 |
tgtagagatgcagatttagttcaaaaaattgcagctgcaacgtcacttgaacttagagcaagtggaactcactatactt |
29610704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 115 - 217
Target Start/End: Complemental strand, 25128882 - 25128780
Alignment:
| Q |
115 |
tagagatgcagatttagttcaaagaattggagctgcaacatcacttgaacttagagcaagtggaactcactatacttgtgctccttgtgtggctgtaggg |
214 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||| | |||||| ||| |||||| |||| |||||||| | |||||||||||| || ||| || |
|
|
| T |
25128882 |
tagagatgctgatttagttagaagaattggagctgcaacggcgcttgaagttaaagcaagcggaattcactataactttgctccttgtgtcgcggtaagg |
25128783 |
T |
|
| Q |
215 |
cat |
217 |
Q |
| |
|
||| |
|
|
| T |
25128782 |
cat |
25128780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University