View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_147 (Length: 267)
Name: NF10092A_low_147
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_147 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 5 - 261
Target Start/End: Complemental strand, 4082892 - 4082634
Alignment:
| Q |
5 |
caatttgttctatgttctttgtcttgttcttgctatttaatggttttgtttcttggcaaatgatgattgaagggtgtctggggaattcaaattcctatag |
104 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4082892 |
caatttgttctatgttctttgtcttgttcctgcgatttaatggttttgtttcttggcaaatgatgattgaagggtgtctggggaattgaaattcctatag |
4082793 |
T |
 |
| Q |
105 |
aaatat--atatggttttgggaaatgatcaaatggaaannnnnnnnnnnnnnnnnnnnnnnnnaagaaaaccgtatatggttgctcaaattttggagttg |
202 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082792 |
aaatatatatatagttttgggaaatgatcaaatggaaattttgttttttggtttggtttgttgaagaaaaccgtatatggttgctcaaattttggagttg |
4082693 |
T |
 |
| Q |
203 |
tagggaaggaaacatgtaggggaaagagagagtctaaacttggaaaatttagttgatag |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082692 |
tagggaaggaaacatgtaggggaaagagagagtctaaacttggaaaatttagttgatag |
4082634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University