View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_153 (Length: 264)
Name: NF10092A_low_153
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_153 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 252
Target Start/End: Original strand, 40810047 - 40810277
Alignment:
| Q |
20 |
aaattttctaaaaagatttggaaaaagtcatagaatacataacggcggtggagaggctagcactgtggggcggtgacaggctgaagaagactggtttgtt |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40810047 |
aaattttctagaaagatttggaaaaagtca--gaatacataacggcggtggagaggctagcactgtgtggcggtgacaggctgaagaagactggtttgtt |
40810144 |
T |
 |
| Q |
120 |
gtggttcacggtggcagtatcgtgctccaccatggtgacgctttatgaaggaaggttgattggtgttgtgtttatcctgtattttattaaactaagattg |
219 |
Q |
| |
|
||||| ||| |||||||||||||||||| |||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
40810145 |
gtggtccacagtggcagtatcgtgctccgccatggtgacgcttgatgaaggaaggttgattgctgttgtgtttatcctgtattttattaaactaagactg |
40810244 |
T |
 |
| Q |
220 |
cttttgtctttttaaatccaaaccattgatttt |
252 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||| |
|
|
| T |
40810245 |
cttttgtctttttgaatccgaaccattgatttt |
40810277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University