View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_155 (Length: 263)
Name: NF10092A_low_155
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_155 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 29145561 - 29145808
Alignment:
| Q |
1 |
gtattgagggtttctttgcattgcaaagggtgtgaagggaagctgaggaaacacatctctaaaatgcaaggtaaggactcgattatgtacatttaaaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29145561 |
gtattgagggtttctttgcattgcaaagggtgtgaagggaagctgaggaaacacatctctaaaatgcaaggtaaggactcgattatgtacatttaaaaaa |
29145660 |
T |
 |
| Q |
101 |
tgtatttaaacgcactaattgatctcgatcatcgatttgaaaccatctttaaataatctttcactgttcaatttaagatcgaacggtcaataaatatgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29145661 |
tgtatttaaacgcactaattgatctcgatcatcgatttaaaactatctttaaataatctttcactgttcaatttaagatcgaacggtcaataaatatgtc |
29145760 |
T |
 |
| Q |
201 |
acgcatttacggattggaattcaaatatgagattttaatgttgttgat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29145761 |
acgcatttacggattggaattcaaatatgagattttaatgttgttgat |
29145808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 73
Target Start/End: Original strand, 40454037 - 40454106
Alignment:
| Q |
4 |
ttgagggtttctttgcattgcaaagggtgtgaagggaagctgaggaaacacatctctaaaatgcaaggta |
73 |
Q |
| |
|
|||||||||||| ||||||| ||||| |||||||||||| | |||||||| |||| | ||||||||||| |
|
|
| T |
40454037 |
ttgagggtttctctgcattgtaaaggttgtgaagggaaggtcaggaaacatctctccagaatgcaaggta |
40454106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University