View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_157 (Length: 262)
Name: NF10092A_low_157
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_157 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 14 - 255
Target Start/End: Original strand, 33025958 - 33026199
Alignment:
| Q |
14 |
gaagacaagaggagaaacatgaaagaagtaaaattgatgcacatgtgaatgatggaaatagatcaacacattctaatcaattttttgaacacaattcagc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33025958 |
gaagacaagaggagaaacatgaaagaagtaaaattgatgcacatgtgaatgatggaaatagatcaacacattctaatcaattttttgaacacaattcagc |
33026057 |
T |
 |
| Q |
114 |
ttatggttcttcaagtagttgtagagaggaacttaagaaagtgattaaggagagtttggttcgacaaaatctattccaaagcacaagcacttctgaagga |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33026058 |
ttatggttcttcaagtagttgtagagaggaacttaagaaagtgattaaggagagtttggttcgacaaaatctattccaaagcacaagtacttctgaagga |
33026157 |
T |
 |
| Q |
214 |
ttggattcagcttcagcagcattcccttctacaagctcaagc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33026158 |
ttggattcagcttcagcagcattcccttctacaagctcaagc |
33026199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University