View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_161 (Length: 261)
Name: NF10092A_low_161
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_161 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 6 - 251
Target Start/End: Complemental strand, 34819188 - 34818942
Alignment:
| Q |
6 |
aatagctgaagtttatgttcagctcttgagctagaatttgcaccaagttctctgccagagggttaactactcttacaaaggcttcaatacttgatctaaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| | |||||||||||||||||| |
|
|
| T |
34819188 |
aatagctgaagtttatgttcagctcttgagctagaatttgcaccaagttctctgccagaggggtaactacttttacaaaagattcaatacttgatctaaa |
34819089 |
T |
 |
| Q |
106 |
ataaaactnnnnnnntt-attagaggttaacaaatatatagatgttaccttaaatacaaaagattcacacatgatgataacaatgcattgtaagaactat |
204 |
Q |
| |
|
| ||| || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34819088 |
aagaaataaaaaaaatttattagagattaacaaatatatagatgttaccttaaatacaaaagattcacacatgatgataacaatgcattgtaaaaactat |
34818989 |
T |
 |
| Q |
205 |
gaaagagatatatatctacctcaaacttttgtgttggtccatatttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34818988 |
gaaagagatatatatctacctcaaacttttgtgttggtccatttttt |
34818942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University