View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_162 (Length: 261)
Name: NF10092A_low_162
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_162 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 7 - 246
Target Start/End: Original strand, 43797898 - 43798137
Alignment:
| Q |
7 |
gattcggaagttgtggtgaaaaatttaaagggatgtaatcctactagtgtagtgggttggtgcttaattaacaagattcttagtttgctttcgatggatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43797898 |
gattcggaagttgtggtgaaaaatttaaagggatgtaatcctactagtgtagtgggttggtgcttaattaacaagattcttagtttgcttgcgatggatt |
43797997 |
T |
|
| Q |
107 |
gggaggttagagtttgtgactagtattgtgcagctaattgatgtgtttatgctcttgttaatatggggtgcgatagcgaggacgcttgaatactttttga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43797998 |
gggaggttagagtttgtgactagtattgtgcagctaattaatgtgtttatgctcttgttaatatggggtgcgatagcgaggacgcttgaatactttttga |
43798097 |
T |
|
| Q |
207 |
gttatgtcttgttcaaactagttggttcgtcattattgat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43798098 |
gttatgtcttgttcaaactagttggttcgtcattattgat |
43798137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University