View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_177 (Length: 256)
Name: NF10092A_low_177
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10092A_low_177 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 37479446 - 37479698
Alignment:
Q |
1 |
taagttattagttttatatcatgtaagaatgactaaatgaatgatatataagagaagcgtttgagcatagagcacatttgaaagagttcacacaatacta |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
37479446 |
taagttattagttttatatcatgtaagaatgaataaatgaatgatatataagataagcgttggagcatagagcacatttgaaagagttcacacaatacta |
37479545 |
T |
 |
Q |
101 |
ggacatataaggtggaggtaggatacttagcgtgt---------tgggtatctgattttgtgatcaggaaaggacacactcaacttgaccaccacacatg |
191 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
37479546 |
ggacatataaggtggaggtaggatacttagcgtgttcttctatatgaatatctgattttgtgatcaggaaaggacacactcaacttgaccaccacacgtg |
37479645 |
T |
 |
Q |
192 |
ttgcagctatttgacaagcccgagctgagtggtatttttattatattattgga |
244 |
Q |
|
|
|||| |||||||||||||| ||||||| |||||||||||||||| || ||||| |
|
|
T |
37479646 |
ttgccgctatttgacaagctcgagctgtgtggtatttttattatttttttgga |
37479698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University