View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_178 (Length: 256)
Name: NF10092A_low_178
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_178 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 37 - 250
Target Start/End: Original strand, 53042565 - 53042768
Alignment:
| Q |
37 |
ttgttgttgtgtgtatatgataaaatcaaaccccaaacaaatacattgctaactcaatgtagctagcaacttactaaataggaaatgtgttgttacagct |
136 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53042565 |
ttgttgttgtgtgtatataataaaatcaaaccccaaacaaatacattgctaactcaatgtagctagcaacttactaaataggaaatgtgttgttacagct |
53042664 |
T |
 |
| Q |
137 |
gaaagacaacggatgacaacgataatgtctatatttggaaataggttttgttttcaatgcagtttcagatcgatggaaaattgtttgaaatcgttaaacg |
236 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53042665 |
gaaa----------gacaacgataatgtctgtatttggaaataggttttgttttcaatgcagtttcagatcgatggaaaattgtttgaaatcgttaaacg |
53042754 |
T |
 |
| Q |
237 |
gaaaaaacagcacc |
250 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
53042755 |
gaaaaaacagcacc |
53042768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University