View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_182 (Length: 254)
Name: NF10092A_low_182
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10092A_low_182 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 5 - 239
Target Start/End: Complemental strand, 41404394 - 41404160
Alignment:
Q |
5 |
cacatatttcatatggtttctgttcaatcgacttagaaggaagtcaaggaacacaattgcttgcgagtagagcacatgccaaaaatgactctaattgact |
104 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41404394 |
cacatatttcatatggtttctgttcaatcgacttagaaggaagtcaaggaacacaattgcttgcgagtagagcacatgccaaaaatgactctaattgact |
41404295 |
T |
 |
Q |
105 |
cgtaatctatcaaacatgtcttatagggtctgattcctactttcatacacatcatttcattgcagccacacgattgaaggtcttttgactgccaaaacca |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
T |
41404294 |
cgtaatctatcaaacatgtcttatagggtctgattcctactttcatacacatcatttcattgcagccacacgattgaaggtcttttgactgcgaatacca |
41404195 |
T |
 |
Q |
205 |
gaatctactatttatagcttcaacgtaaatgtgat |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
41404194 |
gaatctactatttatagcttcaacgtaaatgtgat |
41404160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University