View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_191 (Length: 251)
Name: NF10092A_low_191
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10092A_low_191 |
 |  |
|
[»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 80 - 251
Target Start/End: Original strand, 31251816 - 31251987
Alignment:
Q |
80 |
taacattaaacctgttattttacatactaagtcatnnnnnnnnnnnnnncaatcaaatgatgtgtttcttttctcgtcactgtttctgtttggaactcta |
179 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
T |
31251816 |
taacattaaacctgttattttacatactaagtcataaaaaggaaaaaaacaatcaaatgatgtgtttcttttctcgtcattgtttctgtttggaattcta |
31251915 |
T |
 |
Q |
180 |
gatgtcattcatacacaaacgtagcgatttattaggggtagcattccacaactgcataaaccttctgagctt |
251 |
Q |
|
|
||||||||||||||||||| || | ||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
T |
31251916 |
gatgtcattcatacacaaaagtggtgatttattaggggtagcattccaaaactgcataaaacttctgagctt |
31251987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 129 - 251
Target Start/End: Complemental strand, 25815278 - 25815156
Alignment:
Q |
129 |
caatcaaatgatgtgtttcttttctcgtcactgtttctgtttggaactctagatgtcattcatacacaaacgtagcgatttattaggggtagcattccac |
228 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||||| |
|
|
T |
25815278 |
caatcaaatgatgtgtttcttttctcgtcattgtttctgtttggaactctagatgtcattcatacacaaaagtggtgatttattaggggtagcattccaa |
25815179 |
T |
 |
Q |
229 |
aactgcataaaccttctgagctt |
251 |
Q |
|
|
||||||||||| ||||||||||| |
|
|
T |
25815178 |
aactgcataaaacttctgagctt |
25815156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University