View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_192 (Length: 251)
Name: NF10092A_low_192
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_192 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 247
Target Start/End: Original strand, 30629493 - 30629733
Alignment:
| Q |
7 |
tgtatctttgtattcaacttctagtttgaaggtgcttatgagtttatgctttcttccgattttgtgttgtaaattaaacattttaattttatgctatggt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
30629493 |
tgtatctttgtattcaacttctagtttgaaggtgcttatgagtttatgctttcttccgattttgtgttgtatattaaacattttaattttatgatatggt |
30629592 |
T |
 |
| Q |
107 |
tataatgtagattagggaccaatttgtgattggtttgagacttgagtggtaaggaactcgagtactttaaacaagtggtcagaagtttgatttgtgactc |
206 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30629593 |
tataatgtagattagggaccaacttgtgattggtttgagatttgagtggtaaggaactcgagtactttaaacaagtggtcagaagtttgatttacgactc |
30629692 |
T |
 |
| Q |
207 |
ttgtatttgaagaaaatctagttggaagagaataatctacc |
247 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||| |||| |
|
|
| T |
30629693 |
ttgtatttgaagaaaatctaattggaagagaagaatttacc |
30629733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 204
Target Start/End: Original strand, 34329597 - 34329631
Alignment:
| Q |
170 |
actttaaacaagtggtcagaagtttgatttgtgac |
204 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
34329597 |
actttaaacaagtggtcagatgtttgatttgtgac |
34329631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University