View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_193 (Length: 251)
Name: NF10092A_low_193
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_193 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 7 - 158
Target Start/End: Complemental strand, 19689515 - 19689364
Alignment:
| Q |
7 |
tttggtgtttaaccttaacattcttcttttaatatttctactatattactttacgattaatcttcatttgaaataaagagttctagtcttattttattat |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19689515 |
tttggtgtttaaccttaaccttcttcttttaatatttctactatattactttacgattaatcttcatttgaaataaagagttctagtcttattttattat |
19689416 |
T |
 |
| Q |
107 |
tttcttttgaaatcgcttgctaatgtatggnnnnnnnacgattcagaaactg |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19689415 |
tttcttttgaaatcgcttgctaatgtatggtttttttacgattcagaaactg |
19689364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University