View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_194 (Length: 250)
Name: NF10092A_low_194
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_194 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 29280299 - 29280376
Alignment:
| Q |
1 |
agtgagtcaacataagttcttggaccatggtactaatttggttacttttattctttttgattgagtataggaacaacc |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29280299 |
agtgagtcaacataagttcttggaccatggtactaatttgtttacttttattctttttgattgagtataggaacaacc |
29280376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 194 - 235
Target Start/End: Original strand, 29280492 - 29280533
Alignment:
| Q |
194 |
cctaaaccaccagaaccatgtgtgctttttgtggatttgcat |
235 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29280492 |
cctaaaccaccagaaccatgtgtactttttgtggatttgcat |
29280533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University