View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_199 (Length: 250)
Name: NF10092A_low_199
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_199 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 50157249 - 50157005
Alignment:
| Q |
1 |
attaagttccaacatccatgcactccgctctattatgttttgccaaccgagacagtgccttggagatcataattgcttgatttcgattaaataattgaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
50157249 |
attaagttccaacatccatgcactccgctctattatgttttgccaactgagacagtgccttggagattataattgcttgatttcgattaaataattgaac |
50157150 |
T |
|
| Q |
101 |
tcagttacagtaaaagtgacgagttttcaagttatgtatagaagacttttggataacaatgtaacagtgaatatgctgctcggcnnnnnnncttgtccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
50157149 |
tcagttacagtaaaagtgacgagtgttcaagttatgtatagaatacttttggataacaatgtaccagtgaatatgctgctcggcaaaaaaacttgtccaa |
50157050 |
T |
|
| Q |
201 |
catcaacttttagagtgcattcaaaccattccgaaattctaacga |
245 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50157049 |
cctcaacttttagagtgcattcaaaccattccgaaattctaacga |
50157005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University