View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_200 (Length: 250)
Name: NF10092A_low_200
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_200 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 8 - 204
Target Start/End: Original strand, 45592679 - 45592875
Alignment:
| Q |
8 |
aagcagagaacaagtaagagctttcaccatctaatgtttaattttcaaatttttagaaccttattacatcgagtcatgaatttgatgagcagagctcaga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45592679 |
aagcagagaacaagtaagagctttcaccatctaatgtttaattttcaaatttttagaaccttattacatcgagtcatgaatttgatgagcagagctcaga |
45592778 |
T |
 |
| Q |
108 |
gaagactttcaaccataacagcatgggagaacagtaagaaagctgctaaagaagctgaattgagaaaacttgaggtaagaacttattttatttatat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45592779 |
gaagactttcaaccataacagcatgggagaacagtaagaaagctgctaaagaagctgaattgagaaaacttgaggtaagaacttattttatttatat |
45592875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University