View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_207 (Length: 249)
Name: NF10092A_low_207
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_207 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 12 - 244
Target Start/End: Original strand, 40098040 - 40098290
Alignment:
| Q |
12 |
atgaagagcggagcggccgtcagtgtcacggaaattgacgtcactaccgtcgtctagaagttcggtgattccttctaagtcaccttcgttcgctaaatac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40098040 |
atgaagagcggagcggccgtcagtgtcacggaaattgacgtcactaccgtcgtctagaagttcggtgattccttctaagtcaccttcgttcgctaaatac |
40098139 |
T |
|
| Q |
112 |
atcaaccgaacggtgggatccacca------------------agtcggttacagttacggagacggttactagtgagttgacggtggcggaaccgtcgt |
193 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40098140 |
atcaaccgaacggtgggatccaccaagtcggttacagttacggagtcggttacagttacggagtcggttaccagtgagttgacggtggcggaaccgtcgt |
40098239 |
T |
|
| Q |
194 |
gatccggtgcgagggaagattgtctgccaagtgagaaacgagagtgaagct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40098240 |
gatccggtgcgagggaagattgtctgccgagtgagaaacgagagtgaagct |
40098290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University