View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_213 (Length: 247)
Name: NF10092A_low_213
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_213 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 23 - 221
Target Start/End: Original strand, 15250238 - 15250437
Alignment:
| Q |
23 |
atgatttgcaacgtgttgtgttgtttgggggacctggtggattctgtggtctttgaaacatgtggttgtagatgatattggtcagaatgactttaattta |
122 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15250238 |
atgatttgcaacgtgttgtgttgtttggtggacctggtggattctgtggtctttaaaacatgtggttgtagatgatattggtcagaattactttaattta |
15250337 |
T |
 |
| Q |
123 |
ataaatgtatcatgggttctattttgtttcaaagtgatgatagttaata----ttatttactgttagcatgatgcactaaaaagttaaaacaacaccaaa |
218 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
15250338 |
ataaatgtgtcatgggttctattttgtttcaaag---tgatagttaatattatttatttactgttagcatgatgcactaaaaagttaaaacaacgctaaa |
15250434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University