View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_214 (Length: 247)
Name: NF10092A_low_214
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_214 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 38045724 - 38045498
Alignment:
| Q |
1 |
gtgaatttactaagagctgttcctacaattctcagtgactgaacatatgaaatatgtgcagctgctagtgagcaacggccatcaagcgcttgcctaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38045724 |
gtgaatttactaagagctgttcctacaattctcagtgactgaacatatgaaatatgtgcagctgctagtgagcaacggccatcaagcgcttgcctaacaa |
38045625 |
T |
 |
| Q |
101 |
atttcttcctttcccggcacagttgcagcgccttatcctcctccattttagagcttgaagctcccattttcccaaatctaaattaccttttttgcctttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38045624 |
atttcttcctttcccggcacagttgcagcgccttatcctcctccattttagagcttgaagctcccattttcccaaatctaaattaccttttttgcctttt |
38045525 |
T |
 |
| Q |
201 |
ccctttatgcaaatcctagaccttgat |
227 |
Q |
| |
|
||||||| ||||||||||||||||||| |
|
|
| T |
38045524 |
ccctttaagcaaatcctagaccttgat |
38045498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 35591934 - 35592070
Alignment:
| Q |
1 |
gtgaatttactaagagctgttcctacaattctcagtgactgaacatatgaaatatgtgcagctgctagtgagcaacggccatcaagcgcttgcctaacaa |
100 |
Q |
| |
|
|||||||| || |||||||||||| |||| ||| ||||||||||||||||| || ||||||||||| ||||| || || ||||| ||||||||||||| |
|
|
| T |
35591934 |
gtgaatttcctcagagctgttcctgtaattttcaatgactgaacatatgaaacataagcagctgctagcgagcatcgcccgtcaagtgcttgcctaacaa |
35592033 |
T |
 |
| Q |
101 |
atttcttcctttcccggcacagttgcagcgccttatc |
137 |
Q |
| |
|
||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
35592034 |
atttcttcctttcacggcatagttgaagtgccttatc |
35592070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University