View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_217 (Length: 247)
Name: NF10092A_low_217
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10092A_low_217 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 84 - 235
Target Start/End: Complemental strand, 25933416 - 25933262
Alignment:
Q |
84 |
ttgtatgttaaattaatcatttttcaagaacaaacc---attattgtgttttgatgttaactttctgatttttagagaaagggcgttcaacttagtttaa |
180 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
25933416 |
ttgtatgttaaattaatcatttttcaagaacaaaccgtaattattgtattttgatgttaactttctgattttcagagaaagggcgttcaacttagtttaa |
25933317 |
T |
 |
Q |
181 |
taaaaacgacaacaatcaaacattattccatctccttgactatgagacggatatt |
235 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25933316 |
taaaaacgacaacaatcaaacattattccatctccttgactatgagacggatatt |
25933262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University